Vascular Dementia Biomarker

FYI -

Pat & Dennis Bender Early Dementia Diagnosis & Prognosis Fund

Dennis & Pat 07-84 $C:\Users\jdenb\AppData\Local\Microsoft\Windows\INetCacheContent.Word\Dennis.jpg$ $C:\Users\jdenb\AppData\Local\Microsoft\Windows\INetCacheContent.Word\DSCN2587.jpg$

J. Dennis Bender

Office, Home & Cell Phone: 859-391-5226

5726 La Jolla Blvd. – Suite 311

La Jolla, CA 92037-7345

Office - 100 Riverside Pl. - Suite 303

Covington, KY 41011-5711

We support the development of improved diagnostic methods for the early detection and diagnosis of MCI, Alzheimer’s, vascular and other dementias, their likely prognosis, and best treatment options. We focus on the development of Bayesian-based medical-decision-support systems, comparative-effectiveness research, and the better utilization of these for the above. (After incorporating in KY as a 501(c)(3) in 2002, we dissolved that entity for a simplified form of two entirely self-financed, private philanthropies utilizing a Vanguard Charitable Trust for making annual-research-grants for early-dementia-detection and its correct differential-diagnosis and likely-prognosis. They will continue on, after I am gone, either mentally or physically. Prof.. Randall Bateman is the first of our fund’s research advisors.

See: https://www.alz.org/alzheimers-dementia/research_progress/earlier-diagnosis )

This email address is being protected from spambots. You need JavaScript enabled to view it.

www.JDBender.com – EMS/eVTOL Experimental Aviation Fund (Vanguard Charitable Trust)

www.JDBender.org – Dementia Diagnosis Fund (Vanguard Charitable Trust)

September 5, 2023

“New target for understanding and treating age-related-dementia. . . This is a major-advance that opens-doors for the early-identification of individuals-at-risk and for the development of targeted therapies. It offers considerable hope for our society with regard to neurocognitive-diseases as a whole. . . Preventive-measures would become more-effective with the discovery of new disease-biomarkers that would enable a better identification of people-at-risk. . . The HUG and UNIGE team succeeded by discovering the role of the CCR5-receptor in the development-of-vascular-dementia. The only way to combat it is prevention by controlling-risk-factors such as high-blood-pressure, high-cholesterol, diabetes and smoking.”

This is exactly what my Fund is focused on helping to develop – namely, finding dementia-biomarkers for its early-detection and correct-diagnosis and most-likely-prognosis! Vascular-dementia being the second-most-common form and often misdiagnosed, as was the case of my Father whose atheroscolotic-vascular-dementia was totally misdiagnosed as “AD.” Mixed-forms of MCI, such as my own mild-amnestic-form, are also quite-common and very-frequently also misdiagnosed. (My occasional-word-retrieval-problem is referred to as ‘amnestic-MCI.’ In my own case, it’s very-slow-progress is good-news and the reason for my stress on better forecasting-dementia-prognosis, as well as it’s proper-diagnosis in the first-place.)

They discovered that CCR5 plays a crucial role in brain-cells response to oxidative-stress, a mechanism involved in the death-of-neurons. They also found a link between a specific genetic-variant-of-CCR5, CCR5-Δ32-allele, and that of another protein, apolipoprotein-E (ApoE), well known for its role in age-related dementia. This complex-genetic-association considerably increases the risk-of-vascular-dementia. People-over-the-age-of-80, such as myself, who carry this specific genotype (CCR5-Δ32-allele) are 11-times-more-likely to develop vascular-dementia. So next I obviously need a genetic-test for that CCR5/apolipoprotein-E-(ApoE)-polymorphism, in addition to already knowing my APOEe3/e4-status and numerous other related risk-factors! [https://www.dtapclinic.com/hiv/CCR5-testing-singapore/ and other worldwide genetic-labs can easily perform this sort of test.]

Vascular-dementia is caused by vascular-lesions that disrupt the blood-supply to the brain, leading to the death-of-neurons. There is currently no cure for vascular-dementia, and the only way to combat it is prevention by controlling-risk-factors, such as high-blood-pressure, high-cholesterol, diabetes and smoking; things I have been focusing on doing in recent years, as well as building my now $15.47M Vanguard Trust (as of 9/1/23) two endowment-funds (www.JDBender.com & www.JDBender.org ) for furthering just this sort of research, as well as the aviation-related eVTOL develop effort, long after I am going, going, gone.

Background The chemokine-receptor-5 (CCR5) is a G-protein-coupled-receptor mainly expressed in immune-cells, where, after stimulation by its specific-ligands (chemokine-ligands 3, 4, and 5; CCL3, CCL4, and CCL5), it regulates chemotaxis and cell-activation. Within the central-nervous-system, CCR5 is expressed by glial-cells, neurons, as well as endothelial and vascular smooth-muscle-cells. CCR5 is involved in regulating the inflammatory-response, learning, and memory processes as well as pathological-cell-death.

The risk for old-age-dementia is thought to be modulated by a large number of genetic-variants-with relatively low-penetrance, but high-prevalence. They are not sure about old-age-MCI. New treatment-strategies could also emerge from these results aiming at improving the quality-of-life-and-functionality of those affected and perhaps those of us with only MCI.

As ApoEε4 represents a risk-factor for both AD and for vascular-dementias, they hypothesize that the CCR5-Δ32/ApoEε4-polymorphism-combination could represent a greater-risk-factor than either of the two-polymorphisms taken separately, thus my own request for an additional CCR5-genetic-analysis, as well as already knowing my own ApoEε4 status. The aims of the present study were to analyze the impact of CCR5-deletion on (1) the risk-of-dementia in older-subjects, such as myself, and (2) the molecular-response-of-neurons to oxidative-stress.

New treatments for vascular-dementia might emerged from their observations into two different directions. The developments could be tailored as a direct-stimulation of CCR5-receptors or be based on a better mechanistic understanding of CCR5-neuroprotection. Their approach made it possible to demonstrate that the ApoEε4/CCR5-Δ32-combination generates a higher-risk for vascular or mixed-dementia with a significant-impact-of-age, thus the reason for my requesting this additional CCR5-Δ32-combination genetic-analysis, now that I am 81.

[I am trying to switch to an altered text-annotation system, partially-illustrated in the following, now that the newer AI-techniques have totally-obsoleted my old, very-time-consuming, early key-word/phrase retrieval-system. Old habits are very-hard to change, as I’ve discovered regarding altering my old, now-obsolete, annotation-system. I’ve begun changing what follows the Methods section, but still only partially accomplished this changeover. (Just so hard to stop those old-habits)!]

New Biomarker Could Help Identify People at Risk for Vascular-Dementia

Reviewed by Lily Ramsey, LLM – Sep. 4, 2023 – News Medical.Net - Reviewers' Notes - Download PDF Copy

Dementia is a group of brain-diseases that share similar symptoms, such as memory, language, orientation, and behavioral issues. Vascular-dementia generally develops in the elderly, affecting between 1%-4% of people-over-the-age-of-65, according to Alzheimer's Switzerland.

It is caused by vascular-lesions that disrupt the blood-supply to the brain, leading to the death-of-neurons. There is currently no cure for vascular-dementia, and the only way to combat it is prevention by controlling-risk-factors such as high-blood-pressure, high cholesterol, diabetes and smoking.

Preventive-measures would become more-effective with the discovery of new disease-biomarkers that would enable a better identification of people-at-risk. And this is what the HUG and UNIGE team succeeded in by discovering the role of the CCR5-receptor in the development-of-vascular-dementia.

A New Biomarker for Dementia The study focused on CCR5, a receptor protein linked to chemokines, chemical messengers of the immune-system. The team led by Dina Zekry, Head of the Division of Internal Medicine for the Aged at the HUG and Associate Prof.essor in the Department of Rehabilitation and Geriatrics at the UNIGE Faculty of Medicine, in collaboration with the team led by Karl-Heinz Krause, a Senior Physician in the Department of Diagnostics and Medicine at the HUG and Full Prof.essor in the Department of Pathology and Immunology at the UNIGE Faculty of Medicine, who were both responsible for the study.

They discovered that CCR5 plays a crucial role in brain cells response to oxidative-stress, a mechanism involved in the death of neurons. They also found a link between a specific genetic variant of CCR5 and that of another protein, apolipoprotein E (ApoE), known for its role in age-related dementia.

This complex genetic association considerably increases the risk-of-vascular-dementia.

People-over-the-age-of-80 who carry this specific genotype are 11-times-more-likely to develop vascular-dementia."

Benjamin Tournier, PhD, Biologist, Department of Psychiatry, Hopitaux Universitaires de Geneva

This research of translational nature, a concept that aims to translate fundamental discoveries into concrete clinical applications, has made it possible to clarify the probable mechanisms of dementia through a series of experiments. The research team first highlighted the potential-role-of-CCR5-in-ischaemic-mechanisms by examining mouse-neurons "in-vitro".

They then studied variations in the CCR5 and ApoE genes in a group of 362 people (205 without dementia and 189 with dementia) who agreed to give blood-samples-annually for a duration of 5- years. These findings were then verified on another cohort in Italy (157 individuals without dementia and 620 individuals with dementia), consolidating the robustness of the discovery.

A Major Step Towards Prevention and Treatment Prof. Zekry emphasizes the importance of this discovery as a new target for understanding and treating age-related-dementia. "This is a major advance that opens-doors for the early-identification of individuals-at-risk and for the development of targeted therapies. It offers considerable hope for our society with regard to neurocognitive=diseases as a whole". New treatment-strategies could also emerge from these results aiming at improving the quality-of-life-and-functionality of those affected.

Source: Hôpitaux Universitaires de Genève

Journal Reference: Tournier, B. B., et al. (2023) CCR5 deficiency: Decreased neuronal resilience to oxidative-stress and increased risk of vascular-dementia. Alzheimer’s & Dementia. doi.org/10.1002/alz.13392.

Posted in: Medical Research News | Medical Condition News

Tags: Apolipoprotein, Biomarker, Blood, Blood-Pressure, Brain, Chemokines, Cholesterol, Dementia, Diabetes, Diagnostics, Genes, Genetic, Geriatrics, High-Blood-Pressure, High-Cholesterol, Immune-System, Immunology, in-vitro, Language, Medicine, Neurons, Oxidative-Stress, Pathology, Protein, Psychiatry, Receptor, Research, Smoking, Stress, Vascular

Research Article - Open Access - Alzheimer's & Dementia

CCR5 Deficiency: Decreased Neuronal Resilience to Oxidative-stress and Increased Risk of Vascular-Dementia

Benjamin B. Tournier, Silvia Sorce, Antoine Marteyn, Roberta Ghidoni, Luisa Benussi, Giuliano Binetti, François R Herrmann, Karl-Heinz Krause, Dina Zekry

First published: 25 July 2023 - https://doi.org/10.1002/alz.13392 - Dina Zekry and Karl-Heinz Krause contributed equally to this work.

PDF

Abstract

Introduction As the chemokine receptor5 (CCR5) may play a role in ischemia, we studied the links between CCR5 deficiency, the sensitivity of neurons to oxidative-stress, and the development of dementia.

Methods Logistic-regression-models with CCR5/apolipoprotein-E-(ApoE)-polymorphisms were applied on a sample of 205 cognitively-normal individuals and 189 dementia patients from Geneva. The impact of oxidative-stress on CCR5-expression and cell-death was assessed in mice-neurons.

Results CCR5-Δ32-allele synergized with ApoEε4 as risk-factor for dementia and specifically for dementia-with-a-vascular-component. We confirmed these results in an independent cohort from Italy (157 cognitively-normal and 620 dementia). Carriers of the ApoEε4/CCR5-Δ32 genotype aged ≥80 years have an 11-fold greater risk of vascular-and-mixed-dementia. Oxidative-stress-induced cell death in CCR5^−/− mice neurons.

Discussion We propose the vulnerability of CCR5-deficient-neurons in response to oxidative-stress as possible-mechanisms contributing-to-dementia.

1 Introduction The chemokine-receptor-5 (CCR5) is a G-protein-coupled-receptor mainly expressed in immune-cells, where, after stimulation by its specific-ligands (chemokine-ligands 3, 4, and 5; CCL3, CCL4, and CCL5), it regulates chemotaxis and cell-activation.1 Within the central-nervous-system, CCR5 is expressed by glial-cells, neurons as well as endothelial and vascular smooth-muscle-cells. CCR5 is involved in regulating the inflammatory-response, learning, and memory processes as well as pathological-cell-death.2

Although it has been demonstrated that both CCR5 and its ligands are upregulated in some pathological situations including Alzheimer's disease (AD)2, the beneficial impact of CCR5 expression on cognitive outcome of mouse AD model is still controverted.3^-5 In humans, a 32-base-pair-deletion is responsible for the occurrence of a premature-stop-codon into the CCR5-receptor-locus (CCR5-Δ32), which leads to natural-receptor-dysfunction. Surprisingly, no link between the CCR5-deletion and the risk-of-developing-AD was revealed.5^,6 In very-old-individuals, pure-AD and pure-vascular-dementia are frequent, but mixed-dementia is even-more-prevalent.7 While the rare-cases of AD in young-patients are monogenetic, the risk for old-age-dementia is thought to be modulated by a large number of genetic-variants-with relatively low-penetrance, but high-prevalence.8 Until now, apolipoprotein-E (ApoE)ε4 is the only known genetic-risk-factor strongly associated with old-age-dementia.9 Also, hitherto no specific-risk-factors for old-age-AD versus vascular or mixed-dementia have been identified. The implication of CCR5-Δ32 in the development of vascular-dementias and mixed-dementias is not known. As ApoEε4 represents a risk-factor for both AD and for vascular-dementias,10^,11 we hypothesize that the CCR5-Δ32/ApoEε4-polymorphism-combination could therefore represent a greater-risk-factor than the two-polymorphisms taken separately.

Oxidative-stress induced by the release of reactive-oxygen-species (ROS) is a key-player in neuronal-death and neurodegenerative-diseases.12^-14 In vascular-disorders, as ROS/oxidative-stress is increased, it can be suspected that they participate to neuronal-death and dementia.15 ROS promotes the activation of specific transcription factors, such as p53 or NF-κB, which control the expression of death/survival-related-genes.16 Neuronal-death is increased in response to nerve-transaction, and brain-damage and neuronal-death are increased after cerebral-stroke in CCR5^−/−-deficient-mice as compared to control.17^,18 Thus, these preliminary studies supposed a role of CCR5 in neuroprotective-mechanisms.19 However, the factors regulating CCR5 upregulation in neurons have not been elucidated. Thus, the knowledge of the functional-role of CCR5 in oxidative-stress-environment is lacking.

The aims of the present study were to analyze the impact of CCR5-deletion on (1) the risk-of-dementia in very-old-subjects, and (2) the molecular-response of neurons to oxidative-stress.

[I am trying to switch to a brand-new text-annotation-system, illustrated in the following, now that the newer AI-techniques have totally-obsoleted my old, very-time-consuming early key-word/phrase ID-system. Old habits are very hard to change, as I’ve discovered regarding my old, odd, annotation system.]

2 Methods

2.1 Patients A prospective study was carried out at the Geneva University Hospitals, at the geriatrics hospital, Switzerland. Patients and data collection have been described in a previous study.20 Briefly, patients were recruited by staff members with specific clinical training. The sampling-frame consisted of a complete list of consecutive admissions of patients age range 65-99-years. A random-sample was selected each day, using a computer-generated-random-table. The exclusion criteria were disorders interfering with psychometric-assessment (severe deafness and blindness; major behavioral-disturbances, such as severe aggressiveness, psychotic, suicidal-behavior, persistent-delirium), terminal-illness with an expected survival period of less-than-6-weeks, and living outside of the Geneva-area, due to difficulties in monitoring patients during follow-up. The local ethics committee approved the study protocol and signed written and informed consent was obtained from patients, their families, or legal representatives. Patient history was recorded on a standardized form and a comprehensive assessment was performed by the same geriatrician (Dina Zekry, D.Z.). The Mini-Mental State Examination (MMSE) scores are presented for the Swiss and the Italian populations. The Clinical Dementia Rating (CDR) scores are only presented for the Swiss population due to missing-data on the Italian population. The methods to perform the cognitive diagnostic are given in Supplemental methods.

2.2 Genotype Analyses: CCR5 Gene Amplification and Sequencing The region of the CCR5 gene that flanks the 32-bp deletion was specifically amplified by polymerase-chain-reaction (PCR) from genomic-deoxyribonucleic-acid (DNA) with forward (TCCCAGGAATCATCTTTACCA) and reverse (AGGATTCCCGAGTAGCAGATG) primers and STAR-DNA-polymerase (Takara Bio Inc., Kyoto, Japan), according to the manufacturer's instructions. Observed wild-type and deleted fragments were 183 and 151 bp, respectively.

2.3 ApoE-Genotype The ApoE genotype was analyzed similarly to CCR5, by sequencing PCR fragments obtained from the ApoE coding region (2795-to-3276) using specific-primers. The sequence signals at positions 2901(T/C) and 3041(C/T) were read manually.

2.4 Validation-Study The validation-study was carried out on DNA from a total of n = 777 patients (n = 319 AD, n = 125 vascular-dementia, n = 176 mixed-dementia) and from n = 157 subjects with normal cognitive function age range 48–97-years. Clinical diagnosis for probable-AD, vascular-dementia, and mixed-dementia was made at the MAC Memory Clinic of the IRCCS Centro San Giovanni di Dio Fatebenefratelli (Brescia) according to international guidelines. DNA samples were available from the biological bank of IRCCS Fatebenefratelli Brescia, Italy. Written informed consent was obtained from all subjects.

2.5 Isolation and Culture of Primary Cortical Neurons Cortical neurons were prepared from CCR5^+/+ and CCR5^−/− fetal brains at day E17.5 and were challenged with different chemicals. The detailed procedure is given in Supplemental methods.

2.6 Real-Time Quantitative and Semi-Quantitative End-Point PCR Real-time PCR (qPCR) reactions were performed using Power SYBR Green PCR master-mix (Applied Biosystems) and a Chromo 4TM Real-Time system (Bio-Rad). Quantification was performed at a threshold-detection-line (Ct-value). The Ct-value of each target genes was normalized against that of ribosomal protein S9 (Rps9) and TATA-box-binding-protein (Tbp) mRNAs used as housekeeping-genes. The list of the primers used is given in Table S1.

2.7 Immunofluorescence Details of the procedure are provided in Supplemental methods. Cells were then incubated overnight (4°C) with β3-tubulin (1:2000, Sigma-Aldrich) or NF-κB/p65 (1:500, Abcam) antibodies. Immunodetection was performed using Alexa 488 or Alexa 555 conjugated secondary antibodies (1:1000, Molecular Probes), followed by cell nucleus staining with a 4′,6-diamidino-2-phenylindole (DAPI) solution.

2.8 Chromatin Immunoprecipitation Assay Mouse-primary-cortical-neurons were treated for 1 h with 30 μM H₂O₂ or vehicle. ChIP assay was then performed as previously described21 and fully described in Supplemental methods. The immunoprecipitated DNA and the input chromatin were analyzed by end-point PCR (40-cycles) using promoter-specific primers (Table S1). The specificity of chromatin immunoprecipitation was assessed by PCR using primers located in the CCR5 exon 2.

2.9 Calcein-AM and AlamarBlue Assay Primary-neurons were seeded in 96-well plates and cultured as described above. After 10-days in-vitro (DIV), neurons were exposed to 30 μM H₂O₂ (1 h, 2 h, 3 h) or vehicle. 6 replicates were performed for each condition. At the end of the treatment, medium was removed and a PBS solution with Calcein-AM (1:100, Invitrogen) or AlamarBlue (1:10, Invitrogen) was added to the cells for 40 min. Signals were read by using Fluostar Optima (BMG Labtech).

2.10 Western-Blotting Following chemical challenge, primary neurons were collected and lysed on ice (lysis buffer: 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 10 mM MgCl₂, 1 mM egtazic acid (EGTA), 1% Triton X-100 supplemented with a protease inhibitor cocktail from Roche). A total of 30-μg of proteins per-lane was diluted in a loading buffer and denatured at 70°C for 10 min. Western-blotting was performed with standard procedures using cleaved caspase-3 (1:500, R&D), p53 (1:500, Chemicon), and histone H3 (1:4000, Sigma-Aldrich) antibodies. Optical-densities of the bands were measured using ImageJ software.

2.11 Statistical-Methods Continuous-variables of human-data and preclinical-data are presented as means ± standard deviation (SD). Mann-Whitney-U-tests or Kruskal-Wallis were used to compare data between cognitively-normal and demented-patients respectively between cognitively-normal or patients affected with the main-etiologies-of-dementia. Univariate-analysis was performed to identify-independent-risk-factors associated with dementia in general and with the main-etiologies-of-dementia. Odds-ratios (OR) and 95% confidence-intervals (CI) were calculated. The variables assessed as possible predictors included age, sex, CCR5 and ApoEε4-gene-polymorphisms the 3 latter being treated as binary-variables. Multiple-logistic-regression-analysis was then carried out to assess interactions between variables. Student's t-test, one-way or two-way-analysis-of-variance (ANOVA) followed by post-hoc-Tukey-test (as indicated in the figure legends) were used to analyze preclinical experiments. Statistical-analyses were performed with Stata software version 14.1. For all tests, a p-value inferior to 0.05 was taken as statistically-significant. [All the same sort of analyses that we used in our own analytical work from decades-ago! Now just much easier to do without having to pay for the expensive SAS software that I always used.]

3 Results A total of 394 subjects were enrolled in Geneva. Two of the 394 subjects were homozygous for the CCR5-Δ32-allele (CCR5-Δ32/CCR5-Δ32: 0.5%), 86 were heterozygous (CCR5⁺/CCR5-Δ32: 21.83%), and 306 were homozygous for the wild-type (CCR5⁺/CCR5⁺: 77.67%); 205 were cognitively-normal, and 189 were demented (73 AD, 20 with vascular-dementia, 82 with mixed-dementia, and 14 with other dementias). The frequency of the CCR5-Δ32-allele is not different between the groups (Chi²(2) = 4.4729; p = 0.107). The frequency of the ApoEε4-allele is lower in cognitively-normal (12.2%) compared to patients with dementia of various etiologies (26.5%; Chi²(1) = 12.97; p = 0.0003). Age and gender did not differ between the groups (mean-age: 85.1 ± 6.8; one-way ANOVA; Bartlett's-test-Chi²(2) = 4.24, p = 0.120; F(2; 377) = 4,16; p = 0.0164, but not significant pairwise after Bonferroni-adjustment; women: 73%; Chi²(1) = 0.068); p = 0.793). Table 1 summarizes the demographics, CCR5-Δ32 and ApoEε4-allele frequencies as a function of cognitive-diagnosis. MMSE was not statistically-different between the AD and vascular and mixed-dementia (F(1; 154) = 0.01; p = 0.9149). In the Swiss population, the majority of patients had a mild (46.5%) or a moderate (42.9%) dementia and only 10.6% of patients had a severe one. To measure the impact of cerebral-vascular-lesions, patients with vascular and mixed-dementia were analyzed together.

Table 1

Comparison of CCR5-Δ32 and ApoEε4-allele frequencies between dementia patients, including the various dementia etiologies, and subjects that are cognitively-normal in the Swiss population.

	Normal		All type of dementia		Alzheimer's disease		Vascular and mixed-dementiaa
Ageb,c, b,c	84.5	7.1	86.0	6.4	86.5	6.1	86.4	6.1
Aged	84.7	80.4–90.1	86.3	82.3–90.4	87.0	82.3–90.4	86.4	83.3–90.7
Femalec	151	73.6%	137	72.5%	60	82.2%	67	65.7%
MMSEb	24.0	3.7	17.1	4.7	17.1	4.2	17.0	4.9
MMSEd	24.0	22.0–27.0	17.0	14.0–20.0	17.0	14.0–20.0	18.0	15.0–20.0
CDR 0	205	100.0%	0	0–0%	0	0–0%	0	0–0%
CDR 1	0	0–0%	88	46.5%	34	46.6%	47	46.1%
CDR 2	0	0–0%	81	42.9%	32	43.8%	42	41.2%
CDR 3	0	0–0%	20	10.6%	7	9.6%	13	12.7%
ApoEε4^-/CCR5⁺	143	69.8%	104	55.0%	43	58.9%	51	50.0%
ApoEε4^-/CCR5-Δ32	37	18.0%	35	18.5%	10	13.7%	21	20.6%
ApoEε4⁺/CCR5⁺	21	10.2%	38	20.1%	17	23.3%	21	20.6%
ApoEε4⁺/CCR5-Δ32	4	2.0%	12	6.4%	3	4.1%	9	8.8%
Total	205	100.0%	189	100.0%	73	100.0%	102	100.0%

Note: Data are expressed as number of cases and %.
^a Patients with vascular and mixed-dementia were pooled to measure the impact of cerebral vascular lesions.
^b Data are expressed as means ± SD.
^c There is no statistically significant difference between cognitively-normal subjects and patients with dementia of various etiologies (one-way ANOVA; Bartlett's test Chi²(2) = 4.2451; p = 0.120; F(2; 377) = 4,16; p = 0.0164, but not significant pairwise after Bonferroni adjustment for age and Chi²(1) = 0.0687; p = 0.793 for sex ratio).
^d Data are expressed as median and interquartile range. ApoEε4+: one or two copies of ApoEε4; ApoEε4−: no copies of ApoEε4; CCR5-Δ32: one or two copies of the CCR5-Δ32 bp deleted allele; CCR5+: two copies of the CCR5 wild-type allele. CDR, Clinical Dementia Rating.

3.1 Univariate and Multiple Logistic Regression Analysis Table 2 shows for the Swiss sample univariate and multiple-logistic-regression-analyses, adjusted for age and sex, including the predictive-variables tested: presence or absence of dementia, and dementia etiology (AD or dementia-with-a-vascular-component [vascular and mixed-dementia grouped]).

Table 2

Univariate and multiple logistic regression models of the risk of Alzheimer's disease and vascular or mixed-dementia (the three dependent variables) with cognitively-normal subjects as the reference group (n = 205) according to CCR5 and ApoE genotypes in the Swiss population.

Dependent variables	Dementia (n = 189)			Alzheimer's disease (n = 73)			Vascular or mixed-dementia (n = 102)
	Univariate logistic regression
	Crude OR	95% CI	p	Crude OR	95% CI	p	Crude OR	95% CI	p
ApoEε4⁺a	2.59	1.52–4.39	<0.001	2.72c	1.40–5.27	0.003	3.00	1.65–5.45	<0.001
CCR5-Δ32b	1.32	0.82–2.13	0.247	0.87	0.43–1.73	0.685	1.67	0.97–2.88	0.067
Age	1.04	1.00–1.07	0.018	1.05	1.01–1.09	0.031	1.04	1.01–1.08	0.021
Male vs. female	1.06	0.68–1.65	0.790	0.61	0.31–1.19	0.146	1.46	0.87–2.44	0.148
	Multiple logistic regression
	Adjusted OR	95% CI	p	Adjusted OR	95% CI	p	Adjusted OR	95% CI	p
Association
ApoEε4/CCR5Δ32			0.002			0.026			<0.001
ApoEε4^-/CCR5⁺	1.00	–	–	1.00	–	–	1.00	–	–
ApoEε4^-/CCR5-Δ32	1.30	0.77–2.20	0.328	0.90	0.41–1.96	0.788	1.59	0.85–2.97	0.144
ApoEε4⁺/CCR5⁺	2.49	1.38–4.49	0.002	2.69	1.30–5.56	0.007	2.80	1.41–5.56	0.003
ApoEε4⁺ /CCR5-Δ32	4.13	1.29–13.1	0.017	2.49	0.54–11.58	0.243	6.31	1.86–21.3	0.003
Adjusted for age and sex			<0.001			0.005			<0.001
ApoEε4^-/CCR5⁺	1.00	–	–	1.00	–	–	1.00	–	–
ApoEε4^-/CCR5Δ32	1.35	0.79–2.30	0.265	0.91	0.41–1.99	0.814	1.70	0.90–3.22	0.100
ApoEε4⁺/CCR5⁺	2.47	1.36–4.47	0.003	2.80	1.34–5.86	0.006	2.81	1.40–5.63	0.004
ApoEε4⁺ /CCR5Δ32	4.46	1.39–14.4	0.012	3.57	0.72–17.78	0.121	7.27	2.09–25.2	0.002
Age	1.04	1.00–13.1	0.018	1.05	1.01–1.10	0.026	1.04	1.01–1.09	0.015
Male vs. female	1.12	0.71–1.78	0.612	0.53	0.26–1.07	0.078	1.61	0.94–2.75	0.082

^a ApoEε4⁺: one or two copies of ApoEε4; ApoEε4⁻: no copies of ApoEε4.
^b CCR5-Δ32: one or two copies of the CCR5-Δ32 bp deleted allele; CCR5⁺: two copies of the CCR5 wild-type allele.
^c Bold entries = relevant results.

3.2 Dementia In univariate-analysis, the ApoEε4-allele was found to be an independent-predictor of dementia (OR = 2.59, 95% CI = 1.52–4.39, p < 0.001) even after adjustment for age and sex; while it was not the case for the CCR5-Δ32-allele (OR = 1.32, 95% CI = 0.82–2.13, p = 0.247). Introducing all the variables into the model showed that the ApoEε4-allele remained statistically-significant (OR = 2.49, 95% CI = 1.38–4.49). However, it presented a greater-significance when associated with the CCR5-Δ32-allele, and the risk-of-dementia increased to 4-times that of cognitively-normal patients (OR = 4.13, 95% CI = 1.29–13.15). After adjusting for age and sex, the model remained significant (p < 0.001), with the OR for ApoEε4 combined with CCR5-Δ32-allele-carrying-genotypes reaching 4.46 (95% CI = 1.39–14.42; Table 2).

3.3 Alzheimer's-Disease In univariate-analysis, the ApoEε4-allele was also found to be an independent-predictor-of-AD (OR = 2.72, 95% CI = 1.40–5.27, p = 0.003) even after adjustment for age and sex, while it was not the case for the CCR5-Δ32-allele (OR = 0.87, 95% CI = 0.43–1.73). The introduction of all the variables into the model showed that the ApoEε4-allele was the only-statistically-significant-predictor of AD, even after adjusting for age and sex (OR = 2.80, 95% CI = 1.34–5.86, p = 0.006).

3.4 Vascular and Mixed-Dementia (Dementia With a Vascular-Component) In univariate-analysis, the ApoEε4-allele was found to be an independent-predictor of the outcome (OR = 3.0, 95% CI = 1.65–5.45, p < 0.001), while it was not the case for the CCR5-Δ32-allele which shows only a trend (OR = 1.67, 95% CI = 0.97–2.88, p = 0.067). The introduction of all the variables into the model showed that the ApoEε4-allele remained-statistically-significant (OR = 2.80, 95% CI = 1.41–5.56). However, when associated with the CCR5-Δ32-allele, the significance was greater than with ApoEε4 alone, and the risk-of-dementia increased up to 6-times (OR = 6.31, 95% CI = 1.86–21.38). The model remained significant after adjusting for age and sex, and ApoEε4 combined with CCR5-Δ32-allele-carrying genotypes increased the risk of dementia by a factor of 7.27 (95% CI = 2.09–25.2, p = 0.002).

3.5 Validation-Population To validate our results, we investigated 777 consecutively enrolled subjects (mean-age 78.6 ± 6.4; 69.8% women) from a memory clinic in Brescia; 157 were cognitively-normal, and 620 with dementia (319 AD; 125 vascular-dementia, 176 with mixed-dementia, Table 3). 7 of the 777 subjects were homozygous for the CCR5-Δ32-allele (CCR5-Δ32/CCR5-Δ32: 1.0%), 84 were heterozygous (CCR5⁺/CCR5-Δ32: 9.6%), [hooray for we heterozygotes,] and 686 were homozygous for the wild-type (CCR5⁺/CCR5⁺: 89.5%). Table 3 summarizes the demographics, CCR5-Δ32 and ApoEε4-allele frequencies as a function of cognitive diagnosis. Age and MMSE were statistically higher in the AD group than the vascular and mixed-dementia (Age: F(1; 618) = 23.53; p < 0.0001; MMSE; (F(1; 550) = 11.24; p = 0.0009). Table 4 shows the results for the Italian sample regarding univariate-and-multiple-logistic-regression-analyses. The odds-ratio predicting vascular and mixed-dementia in the unadjusted-model were 1.26 (95% CI = 0.65–2.43; p = 0.49) for CCR5-Δ32-alone, 3.42 (95% CI = 2.13–5.49; p < 0.001) ApoEε4-alone, and 4.92 (95% CI = 1.09–22.2; p = 0.038) for ApoEε4-combined-with-CCR5-Δ32.

After adjusting for age and sex, the progression in the odds-ratio follows the same pattern, but the ApoEε4 combined with CCR5-Δ32 was not-significant (p = 0.076). The fact that in the age- and sex-adjusted model significance was not reached, is most-likely due to the relatively-low-prevalence of CCR5-Δ32-heterozygotes in the Italian sample, but possibly also due to the younger-age (see below). The odds-ratio-predicting-AD was significant for ApoEε4 (3.71, 95% CI = 2.27–6.07; p < 0.001) and ApoEε4 combined with CCR5-Δ32 (4.98, 95% CI = 1.10–22.5; p = 0.037). After adjusting for age and sex, only ApoEε4 (4.28, 95% CI = 2.45–7.47; p < 0.001) was significantly-associated-with-AD-risk (ApoEε4⁺/CCR5-Δ32: 2.81, 95% CI = 0.56–14.1; p = 0.21). We therefore performed a pooled-analysis of the two populations.

Table 3

Comparison of CCR5-Δ32 and ApoEε4-allele frequencies between dementia patients, including the main dementia etiologies, and subjects that are cognitively-normal in the Italian population.

	Normal		All type of dementia		Alzheimer's disease		Vascular and mixed-dementiaa
Ageb	75.0	4.8	79.6	6.4	80.8	5.7	78.3	7.0
Agec	74.0	71.0–78.0	80.0	75.0–84.0	81.0	76.0–85.0	79.0	74.0–83.0
MMSEb	28.2	1.7	16.3	7.4	17.3	6.8	15.2	7.8
MMSEc	29.0	27.0–29.0	18.0	11.0–22.0	19.0	13.0–23.0	17.0	9.0–21.0
Femaled	87	55.4%	455	73.4%	246	77.1%	209	69.4%
ApoEε4^-/CCR5⁺	118	75.2%	310	50.0%	154	48.3%	156	51.8%
ApoEε4^-/CCR5-Δ32	12	7.6%	51	8.2%	31	9.7%	20	6.6%
ApoEε4⁺/CCR5⁺	25	15.9%	233	37.6%	121	37.9%	112	37.2%
ApoEε4⁺/CCR5-Δ32	2	1.3%	26	4.2%	13	4.1%	13	4.3%
Total	157	100.0%	620	100.0%	319	100.0%	301	100.0%

Note: To measure the impact of cerebral vascular lesions, patients with vascular and mixed-dementia were analyzed together. Data are expressed as number of cases and %.
^a Patients with vascular and mixed-dementia were pooled to measure the impact of cerebral vascular lesions.
^b Data are expressed as means ± SD.
^c Data are expressed as median and interquartile range.
^d Bold entries = relevant results. ApoEε4⁺: one or two copies of ApoEε4; ApoEε4⁻: no copies of ApoEε4; CCR5-Δ32: one or two copies of the CCR5-Δ32 bp deleted allele; CCR5⁺: two copies of the CCR5 wild-type allele.

Table 4

Univariate and multiple logistic regression models of the risk of dementia, Alzheimer's disease, and vascular or mixed-dementia (the three dependent variables) with cognitively-normal subjects as the reference group (n = 157) according to CCR5 and ApoE genotypes in the Italian population.

Dependent variables	Dementia (n = 620)			Alzheimer's disease (n = 319)			Vascular or mixed-dementia (n = 301)
	Univariate logistic regression
	Crude OR	95% CI	p	Crude OR	95% CI	p	Crude OR	95% CI	p
ApoEε4⁺a	3.45	2.22–5.39	<0.001	3.49c	2.18–5.58	<0.001	3.42	2.13–5.49	<0.001
CCR5-Δ32b	1.45	0.80–2.64	0.225	1.63	0.87–3.08	0.129	1.26	0.65–2.43	0.494
Age	1.13	1.09–1.16	<0.001	1.22	1.17–1.28	<0.001	1.09	1.05–1.12	<0.001
Male vs. female	0.45	0.31–0.65	<0.001	0.37	0.25–0.56	<0.001	0.55	0.37–0.82	0.003
	Multiple logistic regression
	Adjusted OR	95% CI	p	Adjusted OR	95% CI	p	Adjusted OR	95% CI	p
Association ApoEε4/CCR5Δ32
ApoEε4^-/CCR5⁺	1.00	–	–	1.00	–	–	1.00	–	–
ApoEε4^-/CCR5-Δ32	1.62	0.83–3.14	0.155	1.98	0.97–4.02	0.059	1.26	0.59–2.68	0.547
ApoEε4⁺/CCR5⁺	3.55	2.23–5.64	<0.001	3.71	2.27–6.07	<0.001	3.39	2.07–5.56	<0.001
ApoEε4⁺ /CCR5-Δ32	4.95	1.16–21.1	0.031	4.98	1.10–22.5	0.037	4.92	1.09–22.2	0.038
Adjusted for age and sex
ApoEε4^-/CCR5⁺	1.00	–	–	1.00	–	–	1.00	–	–
ApoEε4^-/CCR5Δ32	1.28	0.64-2.57	0.48	1.66	0.73-3.75	0.223	1.13	0.52-2.47	0.753
ApoEε4⁺/CCR5⁺	3.99	2.45-6.5	<0.001	4.28	2.45-7.47	<0.001	3.71	2.21-6.21	<0.001
ApoEε4⁺ /CCR5Δ32	3.48	0.80-15.2	0.098	2.81	0.56-14.1	0.210	3.99	0.86-18.3	0.076
Age	1.12	1.08-1.16	<0.001	1.21	1.16-1.27	<0.001	1.08	1.05-1.12	<0.001
Male vs. female	0.49	0.33-0.73	<0.001	0.40	0.25-0.66	<0.001	0.55	0.36-0.85	0.007

^a ApoEε4+: one or two copies of ApoEε4; ApoEε4-: no copies of ApoEε4.
^b CCR5Δ32+: one or two copies of the CCR5-32 bp deleted allele; CCR5Δ32-: two copies of the CCR5 wild-type allele.
^c Bold entries = relevant results.

3.6 Pooled Results and Effect of Age After pooling the Swiss and Italian populations (n = 1,171, Table S2) and contrasting the control-group (n = 362) with the vascular and mixed-dementia (dementia-with-a-vascular-component) group (n = 403), the logistic-regression-model adjusted-for-age as a continuous-variable, sex and country showed that the ApoEε4-allele was still statistically-significant (OR = 3.21, 95% CI = 2.22–4.63; p < 0.001; Table S3). When associated with the CCR5-Δ32-allele, the risk of dementia with vascular component increased to 6-times that of normal patients (OR = 5.94, 95% CI = 2.19–16.1; p < 0.001). When repeating the multiple-logistic-regression model in the 494 subjects below-the-age-of-80, a trend toward a significant-effect was observed when considering the odds-ratio associated with ApoEε4 combined with CCR5-Δ32 (OR = 3.43, 95% CI = 0.95–12.4; p < 0.059, Table S4). Of note, considering the 677 subjects aged ≥80, [like me] although the impact of ApoEε4 by itself was significant (OR = 2.42, 95% CI = 1.32–4.42; p = 0.004), the OR associated with ApoEε4 combined with CCR5-Δ32 reached 11.19 (95% CI = 2.36–53.0; p = 0.002, Table S5).

These results were confirmed by repeating the multiple-logistic-regression-model in the 1,171 subjects combining age and genotype-status: ApoEε4 combined with CCR5-Δ32 in subjects < 80 years was not significant (OR = 3.40, 95% CI = 0.94–12.3; p = 0.063), whereas it was very-high in subjects ≥80 years (OR = 10.55, 95% CI = 2.21–50.2; p = 0.003). Considering AD-risk, the logistic-regression-model adjusted-for-age as a continuous-variable, sex and country showed that the ApoEε4-allele was statistically-significant (OR = 3.7, 95% CI = 2.39–5.72; p < 0.001; Table S3) and, when associated with the CCR5-Δ32-allele, the risk of AD increased to 4-times that of normal-patients (OR = 4.03, 95% CI = 1.15–14.1; p = 0.029; Table S3). However, stratifying-by-age, the risk-for-AD was not increased neither in subjects < 80-years nor in subjects ≥80-years, with and without combining age and genotype-status (subjects < 80-years: OR = 2.22, 95% CI = 0.44–11.14; p = 0.331 and OR = 2.36, 95% CI = 0.41–13.47; p = 0.334 and subjects ≥80 years: OR = 4.86, 95% CI = 0.88–26.8; p = 0.07 and OR = 6.11, 95% CI = 0.94–39.6; p = 0.058, with and without combining age and genotype status, respectively).

3.7 Expression of CCR5 in Neurons Is Increased by ROS-Dependent-Neurotoxic-Stimuli To demonstrate possible links between the presence of vascular disorders leading to dementia and the absence of CCR5, a study of the reactivity of CCR5-deficient-neurons was conducted from CCR5-deficient-mice in the C57BL/6 background.22 To mimic the consequences of a vascular-troubles, cortical-neurons were exposed to several neurotoxic-stimuli. Thus, glucose-deprivation (associated with cobalt-chloride) and excitotoxic concentrations of glutamate were used to mimic a hypoxic-environment23 and H₂O₂ was used to directly induce oxidative-stress. All treatments increased CCR5 mRNA levels in neurons from wild-type (WT) animals (Figure 1A). As hypoxia/glucose deprivation and glutamate exert their neurotoxic-action at least in part through generation of ROS,24^,25 oxidative-stress might be a common-denominator of these stimuli that induces-CCR5-upregulation.

Figure 1

Open In Figure-Viewer

Oxidative-stress increases CCR5-expression and induces-CCR5-ligands. (A) Induction of CCR5 mRNA expression by oxidative-stress in wild-type primary-neurons. Wild-type primary neurons at day-10 in-vitro were treated for the indicated time with CoCl₂ (500 μM) in a glucose-deprived (GD) medium, glutamate (100 μM), H₂O₂ (30 μM), or vehicle (control, Ct). The levels of mRNA were determined by Real-Time PCR (n = 4). (B) The levels of CCR5 and CXCR4 mRNA were determined by Real-Time PCR.^**p < 0.01 H₂O₂ 1h versus control. (C) Induction of CCR5 ligands (Ccl3, Ccl4, and Ccl5) by H₂O₂ (30 μM). RT-PCR was performed by using the ribosomal L32 house-keeping-gene as control. Similar results were obtained from 4 independent experiments. ^§p < 0.05, ^§§p < 0.01, and ^§§§p < 0.001 as compared to the respective group control, using one-way-ANOVA followed by Tukey-post-hoc-test.

Therefore, we investigated further the impact of H₂O₂-induced oxidative-stress on CCR5-expression. A three-fold above control increase in CCR5 mRNA within 1-h of H₂O₂ exposure was shown with a slow decline in the next 2-h (Figure 1B). The expression of Cxcr4 (another chemokine-receptor expressed in neurons26) was not affected by H₂O₂ indicating the specificity of oxidative-stress-induced CCR5 mRNA (Figure 1B). Interestingly, mRNA levels of the CCR5 ligands CCL3, CCL4 and CCL5 increased in response to H₂O₂ (Figure 1C), suggesting-CCR5-receptor-activation under our experimental conditions.

3.8 Involvement of NF-κB in neuronal CCR5 upregulation Next, we investigated potential mechanisms of ROS-dependent CCR5-upregulation. By in-silico analysis, we identified two putative binding-sites for the NF-κB subunit p65/RelA within the regulatory regions of the murine CCR5 gene (Figure 2A). We then performed chromatin-immunoprecipitation-assay, in order to demonstrate the binding of NF-κB to CCR5-regulatory-regions. After treatment of neurons with H₂O₂ or vehicle, chromatin was extracted and immunoprecipitated with the NF-κB antibody. We revealed by PCR that the transcription-factor was binding to the two regulatory sequences of the CCR5-promoter in the H₂O₂-treated sample, while no bands were present in the control. Also, by performing PCR with primers designed on the exon-2 of the CCR5-gene, we did not detect any band, indicating that the binding between NF-κB and CCR5 regulatory-regions was specific (Figure 2A).

In addition, pharmacological inhibition of NF-κB-activation with the IkB-α phosphorylation-inhibitor, BAY-11-7082, prevented the upregulation of CCR5 expression in primary cortical neurons treated with H₂O₂ (Figure 2B). We also examined whether p65-activation after H₂O₂-exposure could be influenced by a CCR5-feedback-mechanism, by examining the impact-of-CCR5-deficiency. Using confocal-microscopy, we observed that the nuclear translocation of p65 after H₂O₂ exposure was similar in both CCR5^+/+ and CCR5 knockout-neurons (Figure 2C,D). Therefore, our results showed that in neurons (i) NF binding to CCR5 regulatory sequences elicited the expression of CCR5 and (ii) oxidative-stress induced NF-κB nuclear-translocation that was not reinforced by a CCR5-dependent-feedback-loop.

Figure 2

Open in Figure-Viewer

CCR5-expression in response to oxidative-stress is mediated by NF-κB. (A) Upper: Schematic overview of the murine CCR5 gene. Blue-boxes represent introns, pink-boxes exons, and yellow-boxes (A and B) putative NF-κB/p65 binding elements. Lower: Chromatin immunoprecipitation using an NF-κB/p65 antibody of wild-type neurons after H₂O₂ (30 μM) or vehicle (Ct) treatment. The input samples represent equal fractions of DNA extract collected prior to immunoprecipitation. (B) CCR5 mRNA levels measured by real-time PCR in wild-type neurons pretreated with the NF-κB inhibitor BAY 11-7082 and treated with H₂O₂ (30 μM). ^#p < 0.05 using two-way ANOVA followed by Tukey post-hoc test (n = 4). (C) Nuclear localization of NF-κB/p65 staining in control (Ct) and H₂O₂-treated CCR5^+/+ and CCR5^-/- primary neurons analyzed by an automated image program. ^§§p < 0.01 as compared to the respective control, using one-way ANOVA followed by Tukey post-hoc test. (D) Confocal fluorescence microscopy showing cell morphology (phase-contrast), nuclear counterstaining with DAPI (orange) and NF-κB/p65 staining (green). In the merged images, the nuclear localization of NF-κB is indicated in yellow (Scale bar = 10 μm).

3.9 Enhanced H₂O₂-Elicited Cell-Death in CCR5-Deficient Primary Cortical Neurons We further investigated whether CCR5 has a functional-role in the response to oxidative-stress, and in particular in the regulation-of-neuronal-survival. We therefore isolated primary cortical neurons from control and CCR5-deficent mouse embryos, to assess their response to H₂O₂ independently of non-neuronal-cells. After 3-h of treatment with 30-μM H₂O₂, wild-type neurons did not exhibit major morphological alterations (Figure 3A) and only a modest decrease in cell number was observed (Figure 3B). In contrast, CCR5-knockout induced morphological-alterations with visible signs of neurite-degeneration in neurons exposed to H₂O₂ (Figure 3A). Also, the number of CCR5-deficient-neurons was markedly diminished after H₂O₂-exposure (Figure 3B). Similar results were obtained with other quantitative cell viability assays by using Calcein-AM (Figure 3C) or AlamarBlue (Figure 3D). Although with different extents, due to the specific characteristics of each assay, in both cases we confirmed an increased-death of primary-neurons lacking-CCR5 exposed to H₂O₂, as compared to wild-type.

Figure 3

Open in Figure-Viewer

Oxidative-stress induces cell death of CCR5^−/− neurons. Primary cortical neurons at day-10 in-vitro, were treated with H₂O₂ (30 μM) or vehicle (Ct) for 1–3 h. (A) Representative images of CCR5^+/+ and CCR5^−/− primary neurons treated or not with H₂O₂. Scale bar: 50 μm. (B) Percentage of living cells stained with β3-tubulin (red) and DAPI (blue) after H₂O₂ exposure. (C-D) percentage of dead cells after H₂O₂ exposure in wild-type and CCR5^−/− neuronal cultures using Calcein (C) or AlamarBlue assay (D). (E) Representative immunoblots of p53, cleaved caspase-3 (Casp-3) and histone H3 proteins in primary neurons treated with H₂O₂ (30 μM) for 1, 2, or 3 h. (F-G) Optical density of p53 and cleaved caspase-3 bands normalized to the H3 protein values. ^*p < 0.05, ^**p < 0.01, using two-way ANOVA followed by Tukey post-hoc test (n = 4). The Tukey post hoc tests indicate differences compared to control (§) and between to CCR5^+/+ and CCR5^−/− primary neurons at the same treatment condition (#). The number of symbols indicates the significance level (1: p < 0.05; 2: p < 0.01; 3: p < 0.001).

It has been demonstrated that p53 is one of the major-mediators of ROS-induced-apoptosis.27 Therefore, we evaluated by Western-blotting the levels of p53 and of the apoptotic marker caspase-3. In wild-type-neurons, the levels of both proteins were not markedly affected by H₂O₂ exposure. In contrast, both p53 and active caspase-3 were significantly increased in a time-dependent manner in CCR5-deficient-neurons (Figure 3E–G). Taken together, these data indicated that oxidative-stress-induced cell death is increased in CCR5-deficient-primary-neurons and that CCR5 prevents oxidative-stress-dependent-activation of p53 and caspase-3.

4 Discussion Our study shows for the first-time an association between the presence of the inactive human-form-CCR5-Δ32 (in combination with ApoEε4) and an increased-risk-of-dementia, stronger for vascular and mixed-dementia. The in-vitro-study on mice neurons clarified the possible mechanisms leading to dementia. Oxidative-stress induces an increase in the neuronal expression of CCR5 and this absence in CCR5-deficient-mice leads to neuronal-death. Thus, vascular-damage inducing oxidative-stress could lead to an increase in CCR5 in neurons which would have a protective-role, while in its absence, neurons would be more-vulnerable to apoptosis which could increase the risk-of-onset-of-vascular-dementia.

The co-occurrence of the ApoEε4/CCR5-Δ32-polymorphism combination shows a low-frequency (44/1,171 subjects) but is associated with a significant impact on the risk-of-vascular/mixed-dementia. Importantly, this effect is observed even if 95% of CCR5 carriers are CCR5⁺/CCR5-Δ32 heterozygous. Thus, the subjects are not totally deficient in CCR5 but the loss of a functional-CCR5-allele is sufficient to increase the risk-of-dementia. The increased risk of vascular/mixed-dementia is significant when considering both the original, and the pooled-data-set. However, the subjects of the Italian-cohort showed a significant-effect also for the AD-group. This effect persisted in the analysis of the two cohorts together but with a low-p-value of 0.029. This difference between the two cohorts could at least partly be explained by a significantly-younger-age in the Italian-cohort. In fact, when the analysis is carried-out according-to-age (<80- and ≥80-year groups), the ApoEε4/CCR5-Δ32 polymorphism did not increase the risk for AD. This observation agrees with previous epidemiologic studies showing the absence-of-AD-risk changes according to CCR5-Δ32.28^-31 These investigations showed differences with ours, especially in the experimental-design. They used case-control-protocols, the mean-age is sometime lower than herein and they only included AD-patients and controls. In our study, we prospectively included patients admitted to the Geneva University geriatric hospital in a randomized-fashion. Thus, (1) cognitively-normal patients were chosen in a randomized-manner and were considered as a control-group; (2) the age of the patients included in the study is consistent with the distribution of dementia in the population of industrialized-countries, and (3) all three major types of old-age-dementia were included in our patient-population.

An additional strength of this study is the fact that the same neuropsychologist carried-out neuropsychological-assessment of all patients, increasing the accuracy-of-cognitive-diagnosis. Thus, our randomized patient collection methodology allows to study genetic-factors in an authentic geriatric hospitalized population. Even more important, although the risk-of-dementia is not modified by the ApoEε4/CCR5-Δ32-combination in subjects aged < 80 years, it is drastically-increased in subjects aged ≥80 years as compared to ApoEε4-alone (OR: 11.19 vs. 2.42, respectively, including both Swiss and Italian populations). This specific approach has therefore made it possible to demonstrate that the ApoEε4/CCR5-Δ32-combination generates a higher-risk for vascular or mixed-dementia with a significant-impact-of-age.

To hypothesize the biological-mechanisms involved, we focused on the neuronal-role of CCR5. In response to vascular-damage, oxidative-stress occurs and has been mimicked here by various stimuli. All of them induced neuronal expression of CCR5, thus extending to neurons the observations made on other cell types.32 In addition, our data established redox-sensitive NF-κB-activation as a mediator of CCR5-expression in neurons. The translocation and the binding of NF-κB to the gene encoding CCR5 confirms the hypotheses made in the literature regarding the mode-of-activation of CCR5.33^-35

In CCR5^−/− neurons, oxidative-stress induced morphological alterations with visible signs of neurite-degeneration and increased activated caspase-3 and p53 levels, concomitantly with cell-death suggesting that the mechanism of H₂O₂-induced -ell-death is, at least in part, apoptosis.36 Neuronal-death after nerve-transection or ischemia is increased in CCR5-deficient mice corroborating the idea of an anti-apoptotic role.17^,18 The neurotoxicity effect of the absence of CCR5 was previously hypothesized in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) injection model of Parkinson's-disease, where the decrease in dopamine-neurons was enhanced by CCR5-deficiency.37 Brain-damages in response to stroke are increased in CCR5-deficient mice, but, in contrast to such neuroprotective-effect of CCR5, one study showed a better cognitive outcome in CCR5-Δ32 patients with stroke.38^,39 A protective-role-of-CCR5 was also observed in multiple-sclerosis.40 Thus, in response to oxidative-stress the absence of neuronal-activation of CCR5 mediated by NF-κB activation-pathway confers neurovulnerability with induction of molecular-players in apoptosis and cell-death.

Additionally, some studies have suggested that glial-CCR5, and glial-neuron-CCR5-dependent-interactions result in cell-survival and limitation-of-inflammation.18^,41 However, the CCR5-deletion does not appear to alter the recruitment of glial-cells to the ischemic-stroke-site but could induce a neurotoxicity-pattern at the microglia.17^,18^,42 The kinetics-of-activation of the NF-κB-pathway may also be of importance in the pro- or anti-apoptotic fate of the cellular-response.43^,44 In fact, a rapid activation elicits protective mechanisms, while a persistent activation induces the expression of pro-apoptotic-factors. In our model, we observed that NF-κB is rapidly induced by H₂O₂ and determined the transactivation-of-the-CCR5-gene, suggesting anti-apoptotic-effects. In some other situations, CCR5 may (like NF-κB) be pro-apoptotic.45^,46 Besides a role in neuronal-response to oxidative-stress, studies showing that CCR5 could play a role in blood-vessels-integrity47 suggest a possible implication in vascular-damage. This idea is reinforced by the increased-ischemic-risk in ApoEε4-carriers.48^,49

Several limitations to our preclinical approach must be made. The measurements obtained of CCR5-activation were only conducted at the mRNA-level and we showed that the increase in CCR5-mRNA-levels in the presence-of-H₂O₂ is blocked by an NF-κB-inhibitor, and that H₂O₂ induces the binding of NF-κB to CCR5-regulatory-regions. These observations do not directly demonstrate the stimulation-of-CCR5-transcription by NF-κB and the synthesis of CCR5-protein. It could be envisaged that NF-κB controls by its binding another protein which in turn would allow the increase of CCR5 mRNA-levels. However, even in these cases, the conclusions based on the increased-sensitivity of CCR5^−/− neurons to oxidative-stress in terms of cell-death cannot be questioned, only the mechanisms leading to it could be discussed. Indeed, the CCR5/CCR5-axis involves many molecular-pathways that play roles in resistance-to-apoptosis.50^,51 Further studies could be conducted to determine more-precisely the molecular-mechanisms of the CCR5/CCR5pathways.

The mechanisms by which ApoEε4/CCR5-Δ32 induce a synergic-effect on the onset of dementia remain to be determined. However, it is noteworthy that the major source of ApoEε4 in the brain is astrocytes, which can condition neuronal ApoEε-expression.52 Mice expressing ApoEε4 show increases in memory-deficits, neurodegeneration, and death.53 ApoEε4 was also shown to directl-induce-neuronal-death by apoptosis in in-vitro-cell-culture.54 Moreover, cerebral-organoids from ApoEε4⁺-AD-patients show higher-apoptotic-levels than ApoEε3-carriers, assuming a direct effect of neuronal ApoEε4 in cell-death.55 In a similar way, we observed that neurons from CCR5^−/−-mice showed increased-levels-of-apoptosis. Thus, we can hypothesize that the synergistic-effect between ApoEε4 and CCR5 in the onset-of-dementia originates from the hypersensitivity of neurons to apoptosis accumulated by the presence of both ApoEε4 and CCR5-Δ32.

The potential-clinical-impact of our observations is on the level-of-risk-prediction and the development of novel treatment concepts. Hitherto, genetic-risk-factors in complex-multigenetic-diseases, such as old-age-dementia, do not contribute to patient diagnosis and management. However, the increase-in-risk-of-developing-dementia with a vascular-component for the combined-ApoEε4/CCR5-Δ32-genotype is such that this notion might have to be reconsidered. Presently, vascular-dementia is not curable but preventable.56 Can the ApoEε4/CCR5-Δ32-constellation be used to predict conversion to dementia with a vascular component? In our study, only 4-cognitively-normal ApoEε4/CCR5-Δ32-carriers were observed; thus, the numbers are too small to obtain significant results regarding their conversion-rate. All 4 subjects already converted to dementia with vascular-component; 3 subjects within 3-years and one subject within 4-years since their inclusion. Thus, the conversion-rate of cognitively-normal-participants as a function of the genotype was as follows: ApoEε4⁺/CCR5-Δ32 100%, ApoEε4⁺/CCR5⁺ 50%, ApoEε4⁻/CCR5-Δ32 40%, ApoEε4⁻/CCR5⁺ 30%. Thus, studies will have to address the question whether the ApoEε4/CCR5-Δ32 genotype allows the identification of individuals presenting a higher-risk to develop-dementia with a vascular-component and hence might benefit most from prevention-measures.

Finally, new treatments for vascular-dementia might emerge from our observations into two different directions. The developments could be tailored as a direct-stimulation of CCR5-receptors or be based on a mechanistic understanding of CCR5-neuroprotection.

Acknowledgments The authors have nothing to report. This work was supported by grants from the Swiss National Science Foundation (3200B0-102069 and 33CM30-124111), the Swiss Foundation for Ageing Research (AETAS, D.Z.) and by Italian Ministry of Health (Ricerca Corrente; R.G., L.B., G.B.).

Open-access funding provided by Universite de Geneve.

Conflict of Interest Statement The authors have declared that no conflict of interest exists. Author disclosures are available in the supporting information.

Supporting Information

References

1 - Oppermann M. Chemokine receptor CCR5: insights into structure, function, and regulation. Cell Signal. 2004; 16(11): 1201-1210.